[Tutor] Splitting text
Apparao Anakapalli
appara_akp at yahoo.com
Thu Jun 29 21:45:06 CEST 2006
hello all:
I have a question and I do not know how I can work it
out.
I have a file of sequences
>a
TCCCTGCGGCGCATGAGTGACTGGCGTATTTAGCCCGTCACATTTA'
>b
CCTGCGGCGCATGAGTGACTGGCGTATTTAGCCCGTCACAATTTAA'
....
(10 K)
pattern = 'ATTTA'
I want to find the pattern in the sequence and count.
For instance in 'a' there are two 'ATTTA's.
How can I do that.
One approach tried:
import re
pat = 'ATTTA'
if re.search(pat,a):
print 'yes'
By counting number of yeses I thought I can answer the
question. However, the above approach only looks for
the first instance of pat and says yes and moves to
next.
The other way:
a.find(pat)
This also looks for first one and reports the position
of chracter.
Could any one suggest the best way to cound the number
of patterns.
Thank you
appu
__________________________________________________
Do You Yahoo!?
Tired of spam? Yahoo! Mail has the best spam protection around
http://mail.yahoo.com
More information about the Tutor
mailing list