Need help with a program

[John Posner]

On 1/28/2010 10:50 AM, evilweasel wrote:
> I will make my question a little more clearer. I have close to 60,000
> lines of the data similar to the one I posted. There are various
> numbers next to the sequence (this is basically the number of times
> the sequence has been found in a particular sample). So, I would need
> to ignore the ones containing '0' and write all other sequences
> (excluding the number, since it is trivial) in a new text file, in the
> following format:
>
>> seq59902
> TTTTTTTATAAAATATATAGT
>
>> seq59903
> TTTTTTTATTTCTTGGCGTTGT
>
>> seq59904
> TTTTTTTGGTTGCCCTGCGTGG
>
>> seq59905
> TTTTTTTGTTTATTTTTGGG
>
> The number next to 'seq' is the line number of the sequence. When I
> run the above program, what I expect is an output file that is similar
> to the above output but with the ones containing '0' ignored. But, I
> am getting all the sequences printed in the file.
>
> Kindly excuse the 'newbieness' of the program. :) I am hoping to
> improve in the next few months. Thanks to all those who replied. I
> really appreciate it. :)

Your program is a good first try. It contains a newbie error (looking 
for the number 0 instead of the string "0"). But more importantly, 
you're doing too much work yourself, rather than letting Python do the 
heavy lifting for you. These practices and tools make life a lot easier:

* As others have noted, don't accumulate output in a list. Just write 
data to the output file line-by-line.

* You don't need to initialize every variable at the beginning of the 
program. But there's no harm in it.

* Use the enumerate() function to provide a line counter:

   for counter, line in enumerate(file1):

This eliminates the need to accumulate output data in a list, then use 
the index variable "j" as the line counter.

* Use string formatting. Each chunk of output is a two-line string, with 
the line-counter and the DNA sequence as variables:

   outformat = """seq%05d
   %s
   """

   ... later, inside your loop ...

   resultsfile.write(outformat % (counter, sequence))

HTH,
John