Need help with a program

[evilweasel]

I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample). So, I would need
to ignore the ones containing '0' and write all other sequences
(excluding the number, since it is trivial) in a new text file, in the
following format:

>seq59902
TTTTTTTATAAAATATATAGT

>seq59903
TTTTTTTATTTCTTGGCGTTGT

>seq59904
TTTTTTTGGTTGCCCTGCGTGG

>seq59905
TTTTTTTGTTTATTTTTGGG

The number next to 'seq' is the line number of the sequence. When I
run the above program, what I expect is an output file that is similar
to the above output but with the ones containing '0' ignored. But, I
am getting all the sequences printed in the file.

Kindly excuse the 'newbieness' of the program. :) I am hoping to
improve in the next few months. Thanks to all those who replied. I
really appreciate it. :)